-->
Menu

Perkembangan Biologi Molekuler

Monday, December 6, 2021

Biologi Molekuler --> studi tentang molekul biologis (khususnya protein dan asam nukleat). Proses bioteknologi atau pemanfaataan properti biologi, dapat meningkatkan kualitas hidup di era modern ini.

Sumber : CarisLifeSciences


Pemanfaatan biologi molekuler misalnya pada sintesis dan rekayasa berbagai komponen biologi, biokimia dan medis termasuk dalam diagnosis penyakit, bahan kimia dasar atau bahan makanan. Pengembangan biologi molekuler telah memperkaya pengetahuan tentang fungsi sel dan mengenali struktur molekul yang terlibat.



SEJARAH BIOLOGI MOLEKULER


1. Tahun 1950-an, Penemuan DNA


Gambar Kristalografi DNA oleh Franklin dan Wilkins


Pada 1944, Oswald Avery berhipotesis bahwa biomolekul pembawa bahan genetik adalah asam deoksi nukleat (DNA). 


Francis H. Crick dan James D. Watson pada 1953 memecahkan struktur tiga dimensi DNA, berdasarkan analisis struktur sinar-X dari DNA


Gambar difraksi sinar-X disiapkan oleh Rosalind Franklin dan Maurice Wilkins menunjukkan tidak hanya struktur DNA heliks, tetapi juga lebih dari satu untai polinukleotida per molekul DNA.


Hasil penelitian itu memungkinkan kesimpulan bahwa residu fosfat yang larut dalam air dan basa yang larut dalam air terletak di dalam DNA.


Ini adalah cara untuk menjelaskan sifat DNA yang mudah larut dalam air.


Model struktural yang dikembangkan oleh Watson dan Crick tetap valid hingga saat ini. Mereka menyebut struktur ini heliks ganda DNA.



Watson dan Crick menerima Hadiah Nobel dalam Kedokteran dan Fisiologi pada tahun 1962


Pada tahun 1955, Arthur Kornberg mengisolasi DNA polimerase pertama.


Enzim ini memainkan peran kunci dalam replikasi DNA.


Pada tahun 1958, Francis Crick merumuskan "hipotesis sekuens" dan "dogma sentral" biologi molekuler


Menurut hipotesis sekuens (urutan), spesifitas asam nukleat terletak secara eksklusif pada urutan basa mereka, yang nantinya akan menentukan urutan asam amino dari protein.


 2. Tahun 1960-an, Penemuan Kode Genetik


Pada 1961, Sydney Brenner dan Francis Crick sampai pada kesimpulan penting bahwa setiap elemen pengkodean asam amino (kodon) terdiri dari tiga basa (nukleotida), inilah yang disebut dengan kode genetik.


Tahun 1961, messenger RNA (mRNA) ditemukan oleh Matthew S. Meselson, François Jacob, dan Sydney Brenner.


Marshall Nirenberg tahun 1961 menemukan ribosom berfungsi hanya mensintesis protein sesuai dengan molekul mRNA yang terpasang.


Kode Genetik menentukan asam amino


 

3. Tahun 1970-an, DNA sekuensing


Pada tahun 1975 hingga 1977, Allan Maxam dan Walter Gilbert mengembangkan pengurutan kimia nukleotida (chemical sequencing).


Sebuah fragmen DNA dilabeli secara radioaktif di salah satu ujungnya, didenaturasi, dan dipotong pada nukleotida tertentu melalui metode kimia menggunakan senyawa DMS (dimethyl sulphate).


Urutan nukleotida dapat diidentifikasi dari autoradiogram berdasarkan pemotongan basa nitrogennya dari elektroforesis gel poliakrilamid.


Frederick Sanger dan rekan kerjanya mengembangkan metode pemutusan rantai (chain termination sequencing).


Untai DNA komplementer berlabel disintesis secara in vitro dengan menggunakan dideoksinukleotida (ddNTP) yang mengarah pada terminasi fragmen DNA.


Fragmen yang dihasilkan dipisahkan oleh elektroforesis poliakrilamid dan dievaluasi dalam autoradiogram


Metode terminasi ujung rantai dengan dideoxynucleotida (Sanger Sequencing) lebih banyak digunakan hingga sekarang terutama karena kemampuannya untuk otomatisasi, kualitas urutan dan kemampuan membaca urutan yang lebih panjang.


Sanger Sequencing

Gel Poliakrilamid Probeatau label pewarna


Urutan DNA-nya dibaca secara manual dari gel poliakrilamid atau dibaca menggunakan pewarna (probe/label) disampingnya menggunakan alat detektor.


Pembacaan DNA gambar disamping dari urutan pendek ke panjang yaitu : ATAAAAAACTCAGAACGGCTTCGTA


Pengembangan Sanger Sequencing menggunakan elektroforesis kapiler



Tahun 1973, kloning gen secara selektif dimungkinkan berkat eksperimen terobosan Herbert Boyer, Stanley Cohen, Paul Berg dan rekan-rekannya.


Tahun 1975, Edwin Southern mengembangkan hibridisasi transfer gel untuk mendeteksi sekuens DNA spesifik. 🡪 metodenya dinamakan Southern Blotting


1975, César Milstein, Georges Köhler dan Niels Jerne mempublikasikan prinsip untuk memproduksi antibodi monoklonal.


4. Tahun 1980-an, Reaksi Polimerasi Berantai (Polymerase Chain Reaction- PCR)


Tahun 1985, Kary B. Mullis mengembangkan konsep reaksi rantai polimerase (PCR).

Mesin PCR pertama Karry Mullis


PCR yaitu memperbanyak (amplifikasi) jumlah salinan DNA hingga jumlah tertentu, bahkan dari sampel yang jumlahnya kecil sampai kandungan DNA cukup tersedia untuk analisis lebih lanjut.


Percobaan PCR pertama, menggunakan enzim DNA polimerase dari enterobacteria (E. coli) yang dapat terdegradasi pada suhu di atas 45 °C.


Karena setiap siklus PCR dimulai dengan langkah pemanasan, dalam setiap siklus duplikasi, setelah sampel dipanaskan, enzim polimerase harus ditambahkan terus menerus.


Akhirnya, Mullis memiliki ide cemerlang dan sangat sederhana untuk menggunakan DNA polimerase yang diisolasi dari bakteri termofilik, agar tidak terdegradasi oleh proses denaturasi DNA dengan suhu tinggi.



5. Tahun 1990, Human Genome Project (HGP)


Proyek tersebut yaitu pemetaan seluruh informasi genetik manusia.


Ilmuwan Prancis dan Amerika menerbitkan peta lengkap genom manusia pada tahun 1994 melalui kerjasama Human Genome Project Organization (HUGO) dan perusahaan AS Celera Genomics.


Pada 2005 pekerjaan selesai dilakukan, sesuai rencana.


Higuchi dan rekan kerjanya berhasil mengembangkan kemajuan PCR yang signifikan pada tahun 1993. Quantitative-PCR (qPCR), merupakan analisis kinetika pembentukan produk selama amplifikasi disebut juga Real Time PCR. 


qPCR memberikan kemungkinan memonitor kuantifikasi (penghitungan hasil replikasi) dalam waktu itu juga, tanpa visualisasi menggunakan gel.


6. Tahun 2000, Next Generation Sequencing (NGS)


Pada elektroforesis kapiler sekuenser (capillary electrophoresis sequencers) diperkenalkan pada tahun 1990, yang mengotomatiskan sekuensing Sanger.


Namun, itu hanya dapat melakukan satu operasi baca pada satu waktu dan karenanya bekerja sangat lambat


Pada tahun 2005, teknik sekuensing DNA baru diperkenalkan disebut teknik "Next Generation Sequencing (NGS)”.


NGS menggunakan segmen DNA yang dibagi menjadi potongan-potongan kecil selama proses. Panjang pembacaan hasil sekuensing  perangkat NGS jauh lebih pendek daripada metode sekuensing Sanger. Setelah itu potongan-potongan itu harus dikombinasikan urutannya ke genom lengkap menggunakan bioinformatika.

Alat-alat NGS dari berbagai Platform

Pada tahun 2002, Eckhard Wimmer mensintesis genom lengkap pertama dari virus polio dalam tabung reaksi. Pekerjaan ini dianggap sebagai tonggak sejarah untuk bidang biologi sintetis (synthetic biology) yang sedang berkembang.


7. Tahun 2010, Nanopore Single-Molecule Sequencers


Pada 2010, dipublikasikan metode sekuensing baru berdasarkan teknologi semikonduktor. DNA yang akan diurutkan disimpan dalam ruang reaksi mikro-chamber pada chip semikonduktor. Mikro chamber ini mengandung DNA polymerase dan berbagai nukleotida ditambahkan secara berurutan. 

Oxford Nanopore Technology MinION sequencer



Metode ini menyerupai pendekatan sekuensing-by-sintesis di mana template DNA dilengkapi dengan penggabungan nukleotida berurutan sama. Deteksi basa melalui perubahan nilai pH pada lapisan peka-ion di dalam mikro-chamber.


DONASI INFOLABMED Bantu berikan donasi jika artikelnya dirasa bermanfaat. Donasi akan digunakan untuk memperpanjang domain www.infolabmed.com. Terima kasih.

Contact Form

Name

Email *

Message *

Protected by Copyscape