-->
Menu
  • Info Lab Medik
  • Info Lab Medik

Info Lowongan Pekerjaan

Tokoh

Download

Selamat Datang

Selamat datang di Info Laboratorium Medik, situs berisi informasi seputar dunia TLM (Teknologi Laboratorium Medik) seperti Acara Seminar/Workshop, Materi Kuliah, Lowongan Pekerjaan, dan Berita terbaru seputar dunia Laboratorium Klinik.

Biologi Molekuler --> studi tentang molekul biologis (khususnya protein dan asam nukleat). Proses bioteknologi atau pemanfaataan properti biologi, dapat meningkatkan kualitas hidup di era modern ini.

Sumber : CarisLifeSciences


Pemanfaatan biologi molekuler misalnya pada sintesis dan rekayasa berbagai komponen biologi, biokimia dan medis termasuk dalam diagnosis penyakit, bahan kimia dasar atau bahan makanan. Pengembangan biologi molekuler telah memperkaya pengetahuan tentang fungsi sel dan mengenali struktur molekul yang terlibat.



SEJARAH BIOLOGI MOLEKULER


1. Tahun 1950-an, Penemuan DNA


Gambar Kristalografi DNA oleh Franklin dan Wilkins


Pada 1944, Oswald Avery berhipotesis bahwa biomolekul pembawa bahan genetik adalah asam deoksi nukleat (DNA). 


Francis H. Crick dan James D. Watson pada 1953 memecahkan struktur tiga dimensi DNA, berdasarkan analisis struktur sinar-X dari DNA


Gambar difraksi sinar-X disiapkan oleh Rosalind Franklin dan Maurice Wilkins menunjukkan tidak hanya struktur DNA heliks, tetapi juga lebih dari satu untai polinukleotida per molekul DNA.


Hasil penelitian itu memungkinkan kesimpulan bahwa residu fosfat yang larut dalam air dan basa yang larut dalam air terletak di dalam DNA.


Ini adalah cara untuk menjelaskan sifat DNA yang mudah larut dalam air.


Model struktural yang dikembangkan oleh Watson dan Crick tetap valid hingga saat ini. Mereka menyebut struktur ini heliks ganda DNA.



Watson dan Crick menerima Hadiah Nobel dalam Kedokteran dan Fisiologi pada tahun 1962


Pada tahun 1955, Arthur Kornberg mengisolasi DNA polimerase pertama.


Enzim ini memainkan peran kunci dalam replikasi DNA.


Pada tahun 1958, Francis Crick merumuskan "hipotesis sekuens" dan "dogma sentral" biologi molekuler


Menurut hipotesis sekuens (urutan), spesifitas asam nukleat terletak secara eksklusif pada urutan basa mereka, yang nantinya akan menentukan urutan asam amino dari protein.


 2. Tahun 1960-an, Penemuan Kode Genetik


Pada 1961, Sydney Brenner dan Francis Crick sampai pada kesimpulan penting bahwa setiap elemen pengkodean asam amino (kodon) terdiri dari tiga basa (nukleotida), inilah yang disebut dengan kode genetik.


Tahun 1961, messenger RNA (mRNA) ditemukan oleh Matthew S. Meselson, François Jacob, dan Sydney Brenner.


Marshall Nirenberg tahun 1961 menemukan ribosom berfungsi hanya mensintesis protein sesuai dengan molekul mRNA yang terpasang.


Kode Genetik menentukan asam amino


 

3. Tahun 1970-an, DNA sekuensing


Pada tahun 1975 hingga 1977, Allan Maxam dan Walter Gilbert mengembangkan pengurutan kimia nukleotida (chemical sequencing).


Sebuah fragmen DNA dilabeli secara radioaktif di salah satu ujungnya, didenaturasi, dan dipotong pada nukleotida tertentu melalui metode kimia menggunakan senyawa DMS (dimethyl sulphate).


Urutan nukleotida dapat diidentifikasi dari autoradiogram berdasarkan pemotongan basa nitrogennya dari elektroforesis gel poliakrilamid.


Frederick Sanger dan rekan kerjanya mengembangkan metode pemutusan rantai (chain termination sequencing).


Untai DNA komplementer berlabel disintesis secara in vitro dengan menggunakan dideoksinukleotida (ddNTP) yang mengarah pada terminasi fragmen DNA.


Fragmen yang dihasilkan dipisahkan oleh elektroforesis poliakrilamid dan dievaluasi dalam autoradiogram


Metode terminasi ujung rantai dengan dideoxynucleotida (Sanger Sequencing) lebih banyak digunakan hingga sekarang terutama karena kemampuannya untuk otomatisasi, kualitas urutan dan kemampuan membaca urutan yang lebih panjang.


Sanger Sequencing

Gel Poliakrilamid Probeatau label pewarna


Urutan DNA-nya dibaca secara manual dari gel poliakrilamid atau dibaca menggunakan pewarna (probe/label) disampingnya menggunakan alat detektor.


Pembacaan DNA gambar disamping dari urutan pendek ke panjang yaitu : ATAAAAAACTCAGAACGGCTTCGTA


Pengembangan Sanger Sequencing menggunakan elektroforesis kapiler



Tahun 1973, kloning gen secara selektif dimungkinkan berkat eksperimen terobosan Herbert Boyer, Stanley Cohen, Paul Berg dan rekan-rekannya.


Tahun 1975, Edwin Southern mengembangkan hibridisasi transfer gel untuk mendeteksi sekuens DNA spesifik. 🡪 metodenya dinamakan Southern Blotting


1975, César Milstein, Georges Köhler dan Niels Jerne mempublikasikan prinsip untuk memproduksi antibodi monoklonal.


4. Tahun 1980-an, Reaksi Polimerasi Berantai (Polymerase Chain Reaction- PCR)


Tahun 1985, Kary B. Mullis mengembangkan konsep reaksi rantai polimerase (PCR).

Mesin PCR pertama Karry Mullis


PCR yaitu memperbanyak (amplifikasi) jumlah salinan DNA hingga jumlah tertentu, bahkan dari sampel yang jumlahnya kecil sampai kandungan DNA cukup tersedia untuk analisis lebih lanjut.


Percobaan PCR pertama, menggunakan enzim DNA polimerase dari enterobacteria (E. coli) yang dapat terdegradasi pada suhu di atas 45 °C.


Karena setiap siklus PCR dimulai dengan langkah pemanasan, dalam setiap siklus duplikasi, setelah sampel dipanaskan, enzim polimerase harus ditambahkan terus menerus.


Akhirnya, Mullis memiliki ide cemerlang dan sangat sederhana untuk menggunakan DNA polimerase yang diisolasi dari bakteri termofilik, agar tidak terdegradasi oleh proses denaturasi DNA dengan suhu tinggi.



5. Tahun 1990, Human Genome Project (HGP)


Proyek tersebut yaitu pemetaan seluruh informasi genetik manusia.


Ilmuwan Prancis dan Amerika menerbitkan peta lengkap genom manusia pada tahun 1994 melalui kerjasama Human Genome Project Organization (HUGO) dan perusahaan AS Celera Genomics.


Pada 2005 pekerjaan selesai dilakukan, sesuai rencana.


Higuchi dan rekan kerjanya berhasil mengembangkan kemajuan PCR yang signifikan pada tahun 1993. Quantitative-PCR (qPCR), merupakan analisis kinetika pembentukan produk selama amplifikasi disebut juga Real Time PCR. 


qPCR memberikan kemungkinan memonitor kuantifikasi (penghitungan hasil replikasi) dalam waktu itu juga, tanpa visualisasi menggunakan gel.


6. Tahun 2000, Next Generation Sequencing (NGS)


Pada elektroforesis kapiler sekuenser (capillary electrophoresis sequencers) diperkenalkan pada tahun 1990, yang mengotomatiskan sekuensing Sanger.


Namun, itu hanya dapat melakukan satu operasi baca pada satu waktu dan karenanya bekerja sangat lambat


Pada tahun 2005, teknik sekuensing DNA baru diperkenalkan disebut teknik "Next Generation Sequencing (NGS)”.


NGS menggunakan segmen DNA yang dibagi menjadi potongan-potongan kecil selama proses. Panjang pembacaan hasil sekuensing  perangkat NGS jauh lebih pendek daripada metode sekuensing Sanger. Setelah itu potongan-potongan itu harus dikombinasikan urutannya ke genom lengkap menggunakan bioinformatika.

Alat-alat NGS dari berbagai Platform

Pada tahun 2002, Eckhard Wimmer mensintesis genom lengkap pertama dari virus polio dalam tabung reaksi. Pekerjaan ini dianggap sebagai tonggak sejarah untuk bidang biologi sintetis (synthetic biology) yang sedang berkembang.


7. Tahun 2010, Nanopore Single-Molecule Sequencers


Pada 2010, dipublikasikan metode sekuensing baru berdasarkan teknologi semikonduktor. DNA yang akan diurutkan disimpan dalam ruang reaksi mikro-chamber pada chip semikonduktor. Mikro chamber ini mengandung DNA polymerase dan berbagai nukleotida ditambahkan secara berurutan. 

Oxford Nanopore Technology MinION sequencer



Metode ini menyerupai pendekatan sekuensing-by-sintesis di mana template DNA dilengkapi dengan penggabungan nukleotida berurutan sama. Deteksi basa melalui perubahan nilai pH pada lapisan peka-ion di dalam mikro-chamber.


Selengkapnya
5:24 AM

Komponen utama kromosom pada eukoariota adalah DNA dan protein histon. Protein histon ini bersifat basa, sehingga dapat menetralkan sifat asam dari DNA. Pada dasarnya sel mengandung dua asam nukleat yaitu RNA dan DNA. DNA yang terdapat di nukleus disebut DNA kromosomal, sedangkan DNA lain yang terdapat di dalam sel dan diluar nukleus yaitu DNA mitokondria, DNA kloroplas, dan DNA plasmid, ketiganya disebut DNA ekstrakromosomal


Isolasi DNA | biologi molekuler


Isolasi DNA merupakan tahap pertama dari berbagai teknologi analisis DNA. DNA dapat ditemukan baik pada kromosom inti maupun organel, yaitu pada mitokondria dan kloroplas. Untuk mengekstrak DNA diperlukan langkah-langkah laboratorium untuk memecahkan dinding sel dan membran inti, yang dilanjutkan dengan pemisahan DNA dari berbagai komponen sel yang lain. Pada saat melakukannya, DNA harus dijaga agar tidak rusak dan didapatkan DNA dalam bentuk rantai panjang.


Faktor-Faktor Yang Mempengaruhi Ekstraksi DNA


Proses pengeluaran DNA dari nukleus, mitokondria maupun organel lain - dengan cara diekstraksi atau dilisiskan - biasanya dilakukan dengan homogenasi dengan penambahan bufer ekstraksi atau bufer lisis untuk mencegah DNA rusak. Pada kondisi sampel tertentu, untuk membantu lisis dari membran sel, maka sampel daun dimasukkan dulu ke nitrogen cair dan langsung digerus sebelum ditambahkan bufer ekstraksi. Senyawa yang biasa digunakan untuk memaksimalkan hasil isolat DNA yang murni ditambahkan fenol, kloroform, daun isoamil alkohol. 


Proses selanjutnya adalah pemisahan DNA dari komponen sel  yang lain atau kontaminan yang tidak diinginkan. Pemisahan DNA dari komponen sel DNA dari komponen sel lain, termasuk debris sel, dilakukan dengan sentrifugasi. 


Kontaminan yang umum ditemukan diantaranya adalah polisakarida yang dapat mengganggu proses lanjutan seperti PCR, dimana terjadi hambatan aktivitas Taq polimerase, atau kontaminan lainnyayaitu polifenol yang dalam bentuk teroksidasi akan mengikat DNA secara kovalen. Untuk menghindari terjadinya hal ini, maka jaringan yang digunakan dijaga tetap dingin sebelumdan selama proses ekstraksi. 


Setelah dilakukan ekstraksi, maka proses dilanjutkan dengan presipitasi DNA dengan menggunakan etanol absolut atai isopropanol. Selain DNA, semua bahan yang lain akan larut dalam etanol dingin. Dengan demikian, saat dilakukan sentrifugasi, maka DNA akan mengendap dan terpisah dari senyawa-senyawa  atau bahan lain. Pada sampel darah, presipitasi dilakukan dengan salting-out yaitu supernatan dipisahkan dari protein atau debris sel dengan pemberian larutan garam berkonsentrasi tinggi. Biasanya akan diperoleh supernatan DNA yang kental pada saat dimasukkan ke etanol absolut. Bila hal ini terjadi, siapkan tabung yang berisi 70%-etanol, dan segera ambil DNA tadi dengan mikropipet 1000 ul, dan pindahkan ke tabung yang berisi 70%-etanol. 


Sebagia bahan dasar untuk analisis lanjutan seperti PCR, RFLP, kloning atau sekuensing, maka DNA yang digunakan  harus bersih dari kontaminan (mempunyai kemurnian tinggi) dan memiliki berat molekul yang tinggi. Selama proses ekstraksi DNA, beberapa hal yang dapat terjadi, antara lain :

  • DNA patah-patah selama proses isolasi.
  • DNA terdegradasi oleh enzim nuklease.
  • Terjadi kontaminasi oleh polisakarida. 
  • Metabolit sekunder ikut terisolasi. 


Denaturasi dan Renaturasi DNA

Proses denaturasi dan renaturasi molekul DNA tergantung pada banyak faktor, antara lain :

  1. Suhu. Suhu leleh (melting temperature, Tm) yang tinggi menyebabkan  untai ganda DNA akan terurai menjadi untai tunggal, tetapi bila suhu ini diturunkan secara perlahan, maka akan terjadi renaturasi menjadi untai heliks ganda DNA seperti semula. 
  2. Derajat keasaman (pH) yang ekstrem (pH<3 atau pH>10) dapat menyebabkan DNA terdenaturasi.
  3. Konsentrasi isoelektrolit seperti Na+ dan K pada larutan ekstraksi yang digunakan. 
  4. Perbandingan kandungan antara basa nukleotida GC terhadap AT. Tingginya kandungan GC akan memperlambat proses denaturasi molekul DNA. Sebaliknya, kandungan AT yang tinggi akan menyebabkan pita DNA mudah putus/patah. 



Sumber : Fatchiah, dkk. 2011. Biologi Molekuler. Erlangga : Jakarta


Baca juga : 

Selengkapnya
6:55 AM

Pandemi COVID-19 nyatanya belum usai, kini dunia dihadapkan dengan kemunculan varian baru virus corona yang dinamakan Omicron. Varian baru ini diprediksi memiliki tingkat penularan jauh lebih cepat dibandingkan vairan COVID 19 lainnya. 

Varian Covid Baru OMICRON, Berbahayakah?


Informasi terkait varian Omicorn ini menurut Organisasi Kesehatan Dunia atau WHO telah resmi merilis tingkat keganasan varian baru ini yang tercatat dengan nomor ilmiah B.1.1.529 diberi nama Omicron. WHO pun memastikan bahwa Omicron ini masuk dalam varien of concern atau varian yang menjadi perhatian karena memiliki tingkat penularan tinggi, virulensi tinggi serta menurunkan efektifitas diagnosis dan efikasi vaksin yang ada saat ini. 

Selain itu, angka reproduksi dari Omicron diangka dua yang berarti varian ini beresiko tinggi. Mengakibatkan lonjakan kasus COVID-19. Kemdian, dari rilis resmi yang disampaikan oleh WHO pada tanggal 26 November lalu, Omicron dilaporkan menjadi varian virus corona yang mempunyai banyak mutasi dibandingkan dengan varian lain yang masuk dalam kategori varian of concern. 

Hal inipun turut disampaikan oleh juru bicara Kementrian Kesehatan, Siti Nadia Tarmizi yang mnyatakan ""Efeknya meningkatkan penularan, mempercepat keparahan dan bisa menurunkan efikasi vaksin. Ada 30 mutasi pada varian ini."

Setidaknya sampai dengan saat ini ada 30 mutasi virus omicron yang dilaporkan oleh WHO, kemudian dari para ahlipun mengatakan bahwa tingkat penularannya bisa mencapai 500% atau 5x lipat lebih tinggi jika dibandingkan dengan virus corona yang pertama kali ditemukan di Wuhan, China pada akhir 2019 lalu. 

Varian ini sendiri pertama kali ditemukan di Afrika Selatan dari data sampel pasien yang terkonfirmasi positif COVID-19 pada tanggal 19 November, kemudian hasil pemeriksaan laboratorium pada tanggal 24 November mengkonvirmasi bahwa pasien tersebut terpapar varian baru yaitu Omicron. 


Sejumlah negarapun diketahui telah melaporkan temuan adanya kasus varian Omicron diwilayahnya yaitu mulai dari Afrika Selatan, Inggris, Jerman, kemudian Hongkong. 

Jadi, saat ini setidaknya ada beberapa virus yang harus di waspadai diantaranya adalah alfa, beta, gamma, delta dan yang terakhir adalah Omicron. Dan untuk ke lima dari varian of concern ini disebut memiliki resiko penularan lebih tinggi. 

Pemerintah Indonesia mengambil sikap untuk menyikapi munculnya Omicron ini. Pemerintah melakukan pembatasan ataupun pengetatan dari jalur-jalur pintu masuk ke tanah air. Mekanisme perjalanan internasionalpun ditetapkan, dimana untuk penutupan sementara bagi WNA dari 11 negara ini sesuai dengan surat edaran dari Dirjen Imigrasi Kemenkumham, dimana negara-negara yang dimaksudkan ialah Afrika Selatan, Botswana, Lesotho, Eswatini, Mzambique, Malawi, Zambia, Zimbabwe, Angola, Namibia, Hongkong. 

Kemudian untuk WNI yang berasal dari 11 negara ini tetapmasuk ke Indonesia asalkan wajib menjalani karantina 14x24 jam. Lalu, untuk WNA dan juga WNI yang berasal tidak dari 11 negara ini yang tiba di Indonesia mengalami perubahan pada masa karantinanya, jika sebelumnya wajib karantina 3x24 jam maka saat ini untuk karantina 7x24 jam dan juga rangkaian prosedur PCR tes wajib jika sudah menjalani karantina sesuai dengan batas waktu yang ditentukan. 

Upaya Pencegahan Penyebaran Varian baru Omicron

Upaya yang dapat kita lakukan untuk mencegah virus Omicron ditanah air, tentunya adalah disiplin menerapkan protokol kesehatan 5 M yaitu Menggunakan Masker, Mencuci tangan, Menjaga jarak, Menghindari kerumunan, dan Mengurangi Mobilitas. Hal ini merupakan kunci yang dapat menyelamatkan diri sendiri dan orang-orang disekitar kita. 

Yang paling penting juga adalah untuk dapat meningkatkan vaksinasi COVID-19. Jika Anda belum mendapatkan vaksinasi COVID-19 sebaiknya Anda segera untuk mendapatkan vaksinasi di berbagai fasilitas layanan vaksinasi yang sudah menyediakan vaksinasi COVID-19. (Sumber : https://www.youtube.com/watch?v=48PlCHvHl6w)

Selengkapnya
6:28 AM

Pada proses replikasi biasanya akan terjadi kesalahan, disinilah DNA akan melakukan perbaikan secara otomatis.  

https://www.researchgate.net/figure/Deoxyribonucleic-acid-damage-and-repair-mechanisms-Various-DNA-damaging-agents-cause-a_fig3_324458697
Sumber : https://www.researchgate.net/


REPAIR DNA

DNA akan di copy dalam tubuh (diperbanyak) disebut juga proses replikasi. Terkadang pada proses replikasi ada kesalahan, proses tersebut biasanya disebut sebagai Proofreading (dibaca ulang). Mutagen yang dapat menyebakan mutasi, contoh UV, atau senyawa yang dapat menyebabkan mutasi pada sel makhluk hitip secara otomatis akan melakukan melakukan REPAIR. 

Didalam DNA  Nukleotida selalu berpasangan, basa nitrogen Adenin selalu berpasangan dengan Tinin, Basa nitrogen Guanin selalu berpasangan dengan Cytosin. 

Jika terjadi mutasi/ketidaknormalan, polymerase akan memperbaiki kesalahan, di potong dengan eksos 1. DNA polimerase akan menambahkan nukleotida dengan benar pasangannya. 


Kesimpulan : 

  • DNA Polimerase 2 = melakukan proofreading (pembacaan ulang)
  • Ekso 1 (ekso nuklease) = melakukan pemotongan
  • DNA polimerase 1 = mengganti pada bagian yang salah (termutasi)


Proses Perbaikan DNA

Sel terus-menerus menangani kerusakan DNA mereka yang dapat berasal dari proses endogen, seperti stres replikasi DNA, atau paparan eksogen seperti radiasi pengion dan obat kemoterapi. Agen perusak DNA menimbulkan berbagai jenis kerusakan DNA, dan kegagalan untuk memperbaiki kerusakan dapat mengakibatkan sejumlah kemungkinan konsekuensi yang menghancurkan pada sel, termasuk ketidakstabilan genetik dan akumulasi mutasi yang memicu tumorigenesis. Oleh karena itu, sel telah mengembangkan mekanisme perbaikan yang rumit untuk menangani berbagai jenis kemungkinan lesi DNA yang muncul; semua dengan tujuan melindungi stabilitas genomik.

DNA repair. (Sumber : https://blog.crownbio.com/)
DNA repair. (Sumber : https://blog.crownbio.com/)


Jenis utama mekanisme perbaikan DNA adalah:

Pembalikan Langsung

Pembalikan langsung merupakan bentuk paling sederhana dari perbaikan DNA karena sebagian besar tergantung pada aktivitas protein tunggal tanpa perlu penghapusan nukleotida, resintesis, atau ligasi. Misalnya, O6-metilguanin (O6-mG) adalah lesi genetik berbahaya yang disebabkan oleh mutagen alkilasi. Adanya gugus alkil pada posisi O6 guanin menyebabkan transisi G:C ke A:T dan hambatan dalam transkripsi gen atau replikasi DNA. Dalam proses pembalikan langsung, gugus alkil dihilangkan oleh enzim O6-metilguanin DNA metiltransferase (MGMT) dan nukleotida yang tepat dipulihkan.


Perbaikan eksisi dasar / Base Excision Repair (BER)

BER bertanggung jawab untuk memperbaiki lesi DNA kecil tetapi sangat mutagenik yang merupakan ancaman signifikan terhadap kesetiaan dan stabilitas genom. Lesi DNA ini dapat disebabkan oleh radiasi pengion serta mutagen endogen yang dihasilkan dari peristiwa metabolisme seperti oksidasi, metilasi, deaminasi, atau hilangnya pasangan basa DNA secara spontan. Jalur BER diprakarsai oleh salah satu dari sebelas glikosilase DNA yang menghilangkan basa yang rusak. Setelah eksisi basa, satu set protein yang berbeda mengisi celah yang terbuka dengan basa tunggal (jalur short-patch) atau basa ganda (jalur long-patch).


Perbaikan Eksisi Nukleotida / Nucleotide Excision Repair (NER)

NER mungkin merupakan mekanisme yang paling fleksibel dalam hal keragaman lesi yang dikenali dan diperbaiki. Yang paling signifikan dari lesi ini adalah dimer pirimidin yang diinduksi oleh sinar UV (dimer pirimidin siklobutana dan 6-4 fotoproduk), dan substrat NER lainnya termasuk adduct kimia yang besar, ikatan silang intra-untai DNA, dan beberapa bentuk kerusakan oksidatif. Jenis lesi ini menyebabkan distorsi heliks dupleks DNA dan modifikasi kimia DNA, yang keduanya merupakan ciri khas yang dikenali oleh NER.


NER adalah proses multi-langkah kompleks yang melibatkan jaringan besar lebih dari 30 protein. Dimulai dengan mengenali basa yang rusak, dupleks DNA kemudian dibuka, dan basa yang rusak dihilangkan dengan kompleks perbaikan eksisi yang kemudian diisi dan diikat.


Perbaikan Ketidakcocokan DNA / DNA Mismatch Repair (MMR)

Jalur MMR memainkan peran penting dalam koreksi kesalahan replikasi seperti ketidakcocokan basa-basa dan loop penyisipan / penghapusan (IDL) yang dihasilkan dari kesalahan penggabungan DNA polimerase dari nukleotida dan slip template, masing-masing. MMR juga mengoreksi pasangan yang tidak cocok atau "ketidaksesuaian" yang dihasilkan oleh deaminasi spontan 5-metilsitosin dan heterodupleks yang terbentuk setelah rekombinasi genetik.


Cacat pada jalur ini menghasilkan fenotipe seluler "mutator" yang ditandai dengan peningkatan frekuensi pada mutasi spontan dan peningkatan ketidakstabilan mikrosatelit (MSI). Mutasi pada beberapa gen MMR manusia menyebabkan predisposisi karsinoma kolorektal nonpoliposis herediter (HNPCC), serta berbagai tumor sporadis yang menampilkan MSI.


Perbaikan Double-Strand Break (DSB) / Double-Strand Break (DSB) Repair

DSB adalah lesi genetik yang sangat toksik yang menimbulkan ancaman serius bagi homeostasis seluler karena dapat mempengaruhi transkripsi, replikasi, dan segregasi kromosom. DSB disebabkan oleh berbagai faktor eksogen, seperti radiasi pengion dan bahan kimia genotoksik tertentu, dan faktor endogen, seperti spesies oksigen reaktif, replikasi pemutusan DNA untai tunggal, dan tekanan mekanis pada kromosom.


DSB berbeda dari kebanyakan jenis lesi DNA lainnya terutama karena mereka mempengaruhi kedua untai DNA dan oleh karena itu mencegah penggunaan untai komplementer sebagai cetakan untuk perbaikan (yaitu BER, NER, dan MMR). Kegagalan untuk memperbaiki DSB dapat mengakibatkan ketidakstabilan kromosom yang merusak yang dapat menyebabkan ekspresi gen yang tidak teratur dan peningkatan risiko karsinogenesis.


Sel telah mengembangkan dua jalur perbaikan DSB yang berbeda: rekombinasi homolog (HR), dan penggabungan akhir non-homolog (NHEJ). Sementara sel dapat memilih untuk menggunakan salah satu dari jalur ini untuk memperbaiki DSB, rincian pasti mengapa sel memilih satu jalur di atas yang lain masih belum diketahui. Seleksi tampaknya dipengaruhi oleh tahap siklus sel pada saat kerusakan diperoleh.


SDM

HR menjaga stabilitas genom dengan memperbaiki DSB, celah, dan memulai ulang garpu replikasi yang terhenti. Ini adalah jalur yang relatif lambat tetapi bebas kesalahan yang bergantung pada keberadaan sekuens homolog dalam genom sebagai cetakan untuk menggantikan segmen DNA yang rusak.


NHEJ

Tidak seperti HR, NHEJ tidak memerlukan template DNA (sister chromatid) untuk perbaikan. Sebaliknya, NHEJ beroperasi dengan memodifikasi ujung bebas DNA yang terletak di kedua sisi pemutusan dengan menggunakan berbagai nuklease sehingga ujung-ujungnya menjadi kompatibel (yaitu 3'-hidroksil dan 5'-fosfat), diikuti dengan ligasi dengan enzim DNA ligase. 4. Berbeda dengan HR, NHEJ adalah proses yang relatif cepat tetapi secara intrinsik rawan kesalahan, dan penggunaannya yang berlebihan dapat menyebabkan penataan ulang gen, penghapusan, dan mutasi, yang semuanya dapat menyebabkan sel pasca-replikasi menjadi lebih rentan terhadap DSB.


Protein sensor kerusakan DNA dan protein pensinyalan kerusakan DNA keduanya dapat ditargetkan dengan berbagai agen antikanker.



REPAIR KROMOSOM

Mutasi kromosom, pada keadaan normal ada 46 kromosom. Pada proses pembelahan dari zygote ada ketidaknormalan sehingga menjadi 47 kromosom, sehingga tidak dapat di lakukan repair oleh sel karena mutasinya terllau besar. 

Mutasi ini akan terjadi kelainan perkembangan abnormal sehingga terjadi syndrome, triple x, dll.  


Sumber : 

  • https://blog.crownbio.com/dna-damage-response
  • Catatan kuliah D4 TLM

Baca juga : 

Selengkapnya
7:23 AM

Info Lowongan Kerja Solo Raya terbaru bulan November 2021.  PT Konimex membutuhkan segera karyawan untuk posisi sebagai berikut:

Lowongan Kerja Solo | PT Konimex Membutuhkan SMK dan D3 Analis Kesehatan


PETUGAS TEKNIK

Kualifikasi PETUGAS TEKNIK

  • Pria, usia max. 30 tahun
  • SMK Listrik/Elektro
  • Rata-rata nilai raport kelas 2 min 7
  • Penempatan PT Konimex Sukoharjo
  • Kirimkan Lamaran melalui bit.ly/lamaran_konimex



PETUGAS PRODUKSI/ PETUGAS INSPEKSI

Kualifikasi PETUGAS PRODUKSI/ PETUGAS INSPEKSI

  • Pria, usia max. 30 tahun
  • SMA / SMK semua jurusan
  • Rata-rata nilai raport kelas 2 min 7
  • Penempatan PT Konimex Sukoharjo
  • Tidak buta Warna
  • Tidak memiliki penyakit kulit / menular lainnya
  • Organoleptik berfungsi sempurna
  • Kirimkan Lamaran melalui bit.ly/lamaran_konimex



PETUGAS ANALISA LABORATORIUM

Kualifikasi PETUGAS ANALISA LABORATORIUM

  • Wanita, usia max. 30 tahun
  • SMK Analis Kesehatan / Farmasi
  • Rata-rata nilai raport kelas 2 min 7
  • Penempatan PT Konimex Sukoharjo
  • Kirimkan Lamaran melalui bit.ly/lamaran_konimex


SATPAM

Kualifikasi SATPAM

  • Pria, usia max. 40 tahun
  • SMA/ SMK semua jurusan
  • Memiliki sertifikat pelatihan Satpam
  • Tinggi Badan min. 160 cm, Berat badan min. 50 Kg
  • Sehat Jasmani dan rohani
  • Terbuka untuk Purnawirawan TNI / POLRI
  • Penempatan PT Konimex Sukoharjo
  • Kirimkan Lamaran melalui bit.ly/lamaran_konimex


ASISTEN ANALIS

Kualifikasi ASISTEN ANALIS

  • Wanita, usia max. 30 tahun
  • Lulusan D3 Farmasi / Analis Kesehatan / Analis Kimia
  • Masa studi max. 4 tahun, IPK min 2.50
  • Berdomisili di Jawa Tengah
  • Penempatan Solo
  • Kirimkan Lamaran melalui bit.ly/lamaran_konimex


MEDICAL REPRESENTATIVE

Kualifikasi MEDICAL REPRESENTATIVE

  • Pria/Wanita, usia max. 35 tahun
  • Memiliki motor & SIM C
  • Lebih disukai yang berpengalaman sebagai MR
  • Bersedia ditempatkan di seluruh cabang di Indonesia
  • Kirimkan lamaran Anda melalui http://bit.ly/angket_lamarankonimex
Lamaran paling lambat 30 November 2021. 

Sumber : https://solo.tribunnews.com/2021/11/18/lowongan-kerja-solo-dibutuhkan-medical-representative-penempatan-di-konimex-sukoharjo


Informasi Lowongan Kerja Terbaru Cek Disini :

https://www.infolabmed.com/search/label/Info%20Lowongan%20Pekerja




Selengkapnya
5:49 PM

Contact Form

Name

Email *

Message *

Protected by Copyscape